Izolacja płucna-żyła w przypadku migotania przedsionków u pacjentów z niewydolnością serca

Izolacja tętnic płucnych jest coraz częściej stosowana w leczeniu migotania przedsionków u pacjentów z niewydolnością serca. Metody
W tym prospektywnym, wieloośrodkowym badaniu klinicznym, losowo przydzieliliśmy pacjentów z objawowym, lekoopornym migotaniem przedsionków, frakcją wyrzutową wynoszącą 40% lub mniej, a niewydolnością serca klasy II lub III New York Heart Association poddano izolacji płucnej lub przedsionkowo-komorowej -node ablacja ze stymulacją dwukomorową. Wszyscy pacjenci wypełnili kwestionariusz Minnesota Living with Heart Failure (wyniki wahały się od 0 do 105, z wyższym wynikiem wskazującym gorszą jakość życia) i przeszli echokardiografię oraz 6-minutowy test marszu (złożony pierwszorzędowy punkt końcowy). W okresie 6 miesięcy pacjenci byli monitorowani pod kątem zarówno objawowych, jak i bezobjawowych epizodów migotania przedsionków.
Wyniki
W sumie 41 pacjentów przeszło izolację żyły płucnej, a 40 przeszło ablację węzła przedsionkowo-komorowego ze stymulacją dwukomorową; żadna z nich nie straciła czasu na obserwację po 6 miesiącach. Czytaj dalej Izolacja płucna-żyła w przypadku migotania przedsionków u pacjentów z niewydolnością serca

Toll-like Receptor Receptor 4 i Aspergillosis w transplantacji komórek macierzystych ad 8

Tak więc, pacjenci, którzy przechodzą przeszczepienie komórek krwiotwórczych są chimerami, dla których układ immunologiczny pochodzi częściowo od biorcy (np. Komórek nabłonka) i częściowo od dawcy (komórki hematopoetyczne). Polimorfizmy w genach TLR ulegających ekspresji na powierzchni neutrofilów polimorfojądrowych10 lub w przypadku miejscowych makrofagów, które pochodzą z linii komórek dawcy, mogą zaburzać aktywację komórek i odpowiedzi przeciwgrzybicze. Związek S4 ze zwiększonym ryzykiem inwazyjnej aspergilozy, zaobserwowany w badaniu odkrywania, zaobserwowano również w badaniu walidacyjnym, które obejmowało biorców przeszczepów od pokrewnych dawców i od niepowiązanych dawców. W analizie podgrup stowarzyszenie było obecne wśród pacjentów, którzy otrzymali przeszczepy od niepowiązanych dawców, tak jak to było w badaniu odkrywania, ale nie było obecne wśród biorców przeszczepów od pokrewnych dawców. Czytaj dalej Toll-like Receptor Receptor 4 i Aspergillosis w transplantacji komórek macierzystych ad 8

Toll-like Receptor Receptor 4 i Aspergillosis w transplantacji komórek macierzystych ad 7

Ten haplotyp był obecny w nośnikach dwóch SNPs w silnym sprzęcie nierównowagi (1063G i 1363T), które wpływają na funkcję TLR4. Geny TLR zostały początkowo zidentyfikowane poprzez ich homologię z genem Toll w Drosophila melanogaster, który uruchamia produkcję drosomycyny i jest wymagany do skutecznej ochrony przed infekcjami grzybiczymi. 23 TLR4 ssaków został po raz pierwszy uznany za receptor transbłonowy lipopolisacharydu, kluczowy składnik dla wykrywanie bakterii Gram-ujemnych.24 Kolejne badania wykazały, że TLR4 bierze również udział w rozpoznawaniu ligandów grzybowych, w tym mannanu (pochodzącego z Candida albicans) 25 i glukuronoksylomannanu (pochodzącego z Cryptococcus neoformans) .26 W kilku badaniach podkreślono rolę TLR2 i TLR4 we wrodzonym rozpoznawaniu immunologicznym gatunków Aspergillus.5-10 Chociaż wykazano, że reakcje zależne od TLR2 zwiększają stymulację .-1,3 glukanem poprzez dectin-1, mikrobiologiczne ligandy Aspergillus fumigatus TLR2 i TLR4 nie zostały jeszcze zidentyfikowane.9
Zgłaszano, że SNP TLR4 1063G i 1363T są związane z podatnością na infekcje wywołane przez bakterie Gram-ujemne, 27, 28 C. albicans, 29 gatunków brucella, 30 syncytialnym wirusem oddechowym, 31 i Plasmodium falciparum.32 Osoby heterozygotyczne pod względem SNP 1063G i 1363T wykazują niską odpowiedź na lipopolisacharyd, co zmierzono na podstawie reakcji bronchospastycznej po inhalacji endotoksyny.33 Ponadto stwierdzono, że komórki nabłonka dróg oddechowych izolowane od osób heterozygotycznych wykazują niedobór odpowiedzi na lipopolisacharyd, co sugeruje, że 1063G i 1363T działają w dominujący sposób. w odniesieniu do allelu typu dzikiego.33 Jednak monocyty i krew pełna wyizolowana od osób heterozygotycznych nie wykazywały nieprawidłowej odpowiedzi na lipopolisacharyd, 34,35 co sugeruje, że wpływ tych polimorfizmów może się różnić w zależności od typów komórek lub warunków eksperymentalnych lub polimorfizmów. Czytaj dalej Toll-like Receptor Receptor 4 i Aspergillosis w transplantacji komórek macierzystych ad 7

Izolacja płucna-żyła w przypadku migotania przedsionków u pacjentów z niewydolnością serca ad 8

Odkrycie to sprawia, że ablacja węzła przedsionkowo-komorowego ze stymulacją dwukomorową jest mniej atrakcyjną opcją w ośrodkach, w których dostępne są doświadczone ablatyfory migotania przedsionków w celu wykonania izolacji płucno-żylnej, bardziej definitywnej procedury ablacji. Analiza podgrup wykazała, że w porównaniu z pacjentami z napadowym migotaniem przedsionków, osoby z nieparametrycznym migotaniem przedsionków czerpią więcej korzyści z izolacji płucno-żylnej pod względem frakcji wyrzutowej, 6-minutowego spaceru, jakości życia i lewej przedsionkowa średnica wewnętrzna. Dane te mogą być sprzeczne z konwencjonalną wiedzą, że pacjenci z utrzymującym się lub długotrwałym uporczywym migotaniem przedsionków mają tak zaawansowaną postać migotania przedsionków, że wykluczają izolację płucno-żylną.
Badanie ma kilka ograniczeń. Izolację płucną wykonano w ośrodkach z doświadczonymi ablacją, a zatem wyniki mogą nie być powtarzalne we wszystkich ośrodkach. Czytaj dalej Izolacja płucna-żyła w przypadku migotania przedsionków u pacjentów z niewydolnością serca ad 8

Izolacja płucna-żyła w przypadku migotania przedsionków u pacjentów z niewydolnością serca ad 5

Wolność od migotania przedsionków u pacjentów poddawanych izolacji płucno-żylnej z lub bez leków przeciwarytmicznych (AAD). Wszyscy pacjenci poddawani ablacji węzła przedsionkowo-komorowego ze stymulacją dwukomorową kontynuowali migotanie przedsionków po 3 i 6 miesiącach. Wśród pacjentów poddawanych izolacji płucnej u 78% pacjentów nie stwierdzono migotania przedsionków po 3 miesiącach, z zastosowaniem leków przeciwarytmicznych lub bez nich (ryc. 2). Po 6 miesiącach było osiem powtórzeń procedur nawracającego migotania przedsionków (u czterech pacjentów) i trzepotania przedsionków lub częstoskurcz przedsionkowy (u czterech innych pacjentów), a 88% pacjentów w grupie z izolacją płucno-żylną było wolnych od migotania przedsionków z migotaniem przedsionków. Czytaj dalej Izolacja płucna-żyła w przypadku migotania przedsionków u pacjentów z niewydolnością serca ad 5

Izolacja płucna-żyła w przypadku migotania przedsionków u pacjentów z niewydolnością serca czesc 4

Przy pomocy flebografii preferowano umieszczenie ołowiu zatoki w gałęzi bocznej lub bocznej, jeśli jest to dozwolone przez anatomię żył wieńcowych. Próba defibrylacji została przeprowadzona w celu zapewnienia marginesu bezpieczeństwa co najmniej 10 J. Rodzaje i ustawienia urządzenia oraz czas przedsionkowo-komorowy i czas żyłowo-rozrodczy zostały wybrane przez lekarza. Analiza statystyczna
Pierwszorzędowym punktem końcowym był złożony frakcja wyrzutowa, odległość w 6-minutowym teście marszu i wynik MLWHF po 6 miesiącach. W przypadku tego złożonego punktu końcowego różnicę między badanymi grupami uznano za znaczącą, jeśli wszystkie trzy składniki miały wartości P mniejsze niż 0,05, jeśli dwa składniki miały wartości P mniejsze niż 0,025, lub jeśli jeden składnik miał wartość P mniejszą niż 0,05; niż 0,017. Czytaj dalej Izolacja płucna-żyła w przypadku migotania przedsionków u pacjentów z niewydolnością serca czesc 4

Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego cd

Do analiz K-ras zastosowano następujące zagnieżdżone zestawy starterów dla eksonu 2: huKRAS2 ex2F, 5 GAATGGTCCTGCACCAGTAA3 ; huKRAS2 ex2R, 5 GTGTGACATGTTCTAATATAGTCA3 ; huKRAS ex2Fint, 5 GTCCTGCACCAGTAATATGC3 ; i huKRAS2 ex2Rint, 5 ATGTTCTAATATAGTCACATTTTC3 . Każdy koktajl po 25 .l reakcji łańcuchowej polimerazy (PCR) zawierał co najmniej 15 ng genomowego DNA, 2,5 mM chlorku magnezu, 300 mM trifosforanów deoksynukleotydu i 2,5 U polimerazy DNA AmpliTaq Gold (Applied Biosystems). Warunki PCR były następujące: cykl w 94 ° C przez 10 minut; 45 cykli w 94 ° C przez 30 sekund, 64 ° C przez 30 sekund i 72 ° C przez 30 sekund; następnie cykl w 72 ° C przez 7 minut. Sekwencjonowanie wydłużania startera przeprowadzono za pomocą zestawu do sekwencjonowania cykli BigDye Terminator v3.1 (Applied Biosystems). Reakcje przeprowadzono na analizatorze DNA 3730×1 (Applied Biosystems). Czytaj dalej Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego cd

Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego ad

Oceniliśmy także związek statusu mutacji K-ras z przeżywalnością całkowitą i czasem przeżycia bez progresji u pacjentów otrzymujących tylko najlepszą opiekę wspomagającą. Metody
Komitet badań, który obejmował członków NCIC CTG i AGITG zaprojektował badanie. NCIC CTG zebrała i przeanalizowała dane oraz zachowała pełne, nieograniczone prawo do przekazywania danych do publikacji. Jeden z autorów akademickich dokonał przeglądu wszystkich danych, inny przeprowadził analizy statystyczne, a trzeci napisał pierwszy szkic manuskryptu; autorzy zapewniają rękojmię za kompletność i dokładność prezentowanych danych. Pierwotny projekt manuskryptu został przejrzany i skomentowany przez wszystkich autorów, a także przez pracowników Bristol-Myers Squibb, którzy nie wprowadzili istotnych zmian. Czytaj dalej Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego ad