Skutki sercowo-naczyniowe po zmianie zasad dotyczących recept na klopidogrel ad 6

Nie byliśmy w stanie ustalić, czy niektórzy pacjenci zdecydowali się zapłacić za lek bezpośrednio, dostali próbki lub mieli prywatny plan leczenia obejmujący leki. Jednakże, jeśli jakikolwiek pacjent uzyskał klopidogrel za pomocą innych środków, co skutkuje wyższym niż mierzone użyciem klopidogrelu w początkowym okresie wstępnej autoryzacji, rzeczywista różnica w wynikach między okresami polis mogła być nawet większa niż to, co znaleźliśmy. W naszym badaniu częstość stosowania klopidogrelu około 90% w ciągu 30 dni po wypisaniu ze szpitala w okresie ograniczonego używania jest zgodna z tymi zgłaszanymi w CRUSADE (Can Rapid Risk Stratyfikacja niestabilnych pacjentów z dławicą tłumi niekorzystne wyniki z wczesnym wdrożeniem American College of Cardiology / American Heart Association Guidelines) z udziałem pacjentów z ostrymi zespołami wieńcowymi bez uniesienia odcinka ST, którzy przeszli PCI.21 W okresie badania stosowanie leków o wtórnej prewencji było powyżej lub blisko kanadyjskiego wskaźnika jakości punkty odniesienia.22 Używanie statyny przekroczyło poziom odniesienia wynoszący 70%, podczas gdy stosowanie inhibitorów ACE i beta-blokerów było o około 10% niższe niż w przypadku wzorców 85%. Tempo zażywania kwasu acetylosalicylowego w ciągu 7 dni po wypisaniu ze szpitala było niskie i wyniosło około 30%, co było zgodne z naszymi poprzednimi wynikami.23,24 W Ontario koszty pozaszpetrowe aspiryny mogą być niższe niż pobierane przez kopertę. poprzez rządowy plan recepty. Czytaj dalej Skutki sercowo-naczyniowe po zmianie zasad dotyczących recept na klopidogrel ad 6

Skutki sercowo-naczyniowe po zmianie zasad dotyczących recept na klopidogrel ad 5

Analiza podgrup przeprowadzona z udziałem jedynie pacjentów otrzymujących stent z gołym metalem zarówno w okresie uprzedniego zezwolenia, jak iw okresie ograniczonego stosowania potwierdziła znaczące zmniejszenie rocznego wyniku złożonego, z 15% do 11%, przy użyciu chi -square analysis (P <0,001). Dyskusja
W badaniu populacyjnym wykazaliśmy, że zmiana polityki refundacji klopidogrelu na politykę ograniczonego zastosowania w odniesieniu do refundacji klopidogrelu wiązała się ze znacznym wzrostem zapotrzebowania na klopidogrel u osób, które przeżyły zawał mięśnia sercowego po PCI z implantacją stentów . Wykazaliśmy również, że wzrost liczby zaleceń klopidogrelu odpowiadał zmniejszeniu niekorzystnych zdarzeń sercowo-naczyniowych po roku. Odkrycia te sugerują, że zmiana polityki, która zwiększyła szybki dostęp do ostrego wymaganego leczenia, mogła mieć znaczący wpływ na schematy przepisywania i wyniki leczenia dla pacjentów. Następstwem jest to, że polityka, która ogranicza dostęp do leku do pilnego wskazania, może w sposób niezamierzony doprowadzić do niepożądanych skutków dla pacjentów. Czytaj dalej Skutki sercowo-naczyniowe po zmianie zasad dotyczących recept na klopidogrel ad 5

Toll-like Receptor Receptor 4 i Aspergillosis w transplantacji komórek macierzystych ad 6

W badaniu walidacyjnym potwierdzono związek dawcy TLR4 S4 z ryzykiem inwazyjnej aspergilozy (skorygowany iloraz szans, 2,49, 95% CI, 1,15 do 5,41, P = 0,02) (Tabela 3). W analizie podgrup powiązanie między S4 i inwazyjną aspergilozą było istotne wśród biorców przeszczepów od niespokrewnionych dawców (skorygowany iloraz szans, 5,00; 95% CI, 1,04 do 24,01; P = 0,04) (tabela 3), ale nie wśród biorców przeszczepów od pokrewnych dawców (skorygowany iloraz szans, 2,29; 95% CI, 0,93 do 5,68; P = 0,07). W badaniu walidacyjnym nie zaobserwowano związku między S3 a inwazyjną aspergilozą. Jednak w tej grupie haplotyp S2 miał skłonność do zwiększania ryzyka inwazyjnej aspergilozy (skorygowany iloraz szans 1,86, 95% CI, 1,01 do 3,44, P = 0,05); ten haplotyp był obecny w nosicielach TLR4 + 12186G, a ten allel również zwiększał ryzyko inwazyjnej aspergilozy w modelu SNP (skorygowany iloraz szans, 2,18, 95% CI, 1,13 do 4,21, P = 0,02). Ocena ryzyka przed transplantacją komórek krwiotwórczej
Tabela 4. Czytaj dalej Toll-like Receptor Receptor 4 i Aspergillosis w transplantacji komórek macierzystych ad 6

Toll-like Receptor Receptor 4 i Aspergillosis w transplantacji komórek macierzystych ad 5

Nawroty choroby nowotworowej, kolejne przeszczepy komórek krwiotwórczych i śmierć uznano za konkurencyjne ryzyko. Wartości P zostały obliczone przy użyciu testu log-rank. Ponieważ zarówno wirus cytomegalii (CMV) serostatus, jak i haplotypy receptora Toll-like receptora 4 (TLR4) można ocenić przed przeszczepieniem komórek krwiotwórczych, skumulowane przypadki były stratyfikowane według CMV serostatus (CMV- oznacza dawców ujemnych względem CMV i biorców ujemnych pod względem CMV) versus inni pacjenci (CMV + oznacza dawców nie biorących w teście CMV i biorców CMV-dodatnich, dawców CMV-dodatnich i biorców CMV-dodatnich oraz dawców CMV-dodatnich i biorców ujemnych pod względem CMV) oraz obecność lub brak dawcy S4 (S4 + lub S4- ). W panelu D haplotypy zostały wywiedzione dla białych dawców i biorców razem z użyciem oprogramowania SAGE. TLR4 1063 A / G i 1363 C / T są w silnym braku sprzężenia i mogą być stosowane zamiennie w haplotypach sześciu locus i trzech locus. Czytaj dalej Toll-like Receptor Receptor 4 i Aspergillosis w transplantacji komórek macierzystych ad 5

Toll-like Receptor Receptor 4 i Aspergillosis w transplantacji komórek macierzystych czesc 4

Warunkową regresję logistyczną zastosowano w analizie danych z badania walidacyjnego do kontroli przypadku, z wykorzystaniem podobnych metod selekcji zmiennych. Ze względu na dużą liczbę porównań statystycznych dokonanych w badaniu odkrywczym, przedstawione wartości P należy interpretować ostrożnie. Aby ułatwić tę interpretację, podajemy wartości P, które pozostałyby znaczące przy stosowaniu tradycyjnych poprawek Bonferroniego do wielokrotnych porównań. Spośród 20 zbadanych SNP stwierdzono, że dwie pary SNP wykazują silną nierównowagę sprzężeń: TLR4 1063 A / G i TLR4 1363 C / T (R2 = 0,96) i TLR9 +1174 G / A i TLR9 1635 A / G ( R2 = 0,96); ustalenia te są zgodne z poprzednimi obserwacjami.21,22 Ponieważ analizy dla tych SNP są zbędne, rozważono 18 niezależnych testów dla korekty wielokrotnego testowania. W przypadku haplotypów rozważaliśmy cztery niezależne testy (tj. Czytaj dalej Toll-like Receptor Receptor 4 i Aspergillosis w transplantacji komórek macierzystych czesc 4

Toll-like Receptor Receptor 4 i Aspergillosis w transplantacji komórek macierzystych cd

Przeprowadzono analizę podgrup, aby uwzględnić różnice w typach przeszczepów komórek krwiotwórczych. Choroba przeszczepu przeciw gospodarzowi (GVHD) i cytomegalii (CMV) została zdiagnozowana zgodnie ze standardowymi definicjami.14-16 Wszyscy pacjenci otrzymali ogólnoustrojową profilaktykę antybiotykową w okresie neutropenii, a także profilaktycznie acyklowir, trimetoprim-sulfametoksazol lub dapson, oraz flukonazol, do 75. dnia po przeszczepieniu komórek krwiotwórczych. Niewielka liczba pacjentów (35 pacjentów w badaniu odkrywczym i 13 w badaniu walidacyjnym) otrzymywała profilaktykę itrakonazolu lub worykonazolu na podstawie decyzji indywidualnego lekarza lub jako część prospektywnego, randomizowanego badania skuteczności profilaktyki itrakonazolem w stosunku do profilaktyki flukonazolem. 17
Pacjenci i dawcy wyrazili pisemną zgodę na zbieranie danych, przechowywanie komórek i kriokonserwację. Czytaj dalej Toll-like Receptor Receptor 4 i Aspergillosis w transplantacji komórek macierzystych cd

Toll-like Receptor Receptor 4 i Aspergillosis w transplantacji komórek macierzystych ad

Postawiliśmy hipotezę, że polimorfizmy w genach TLR od dawcy i biorcy mogą wpływać na podatność na inwazyjną aspergilozę u biorców przeszczepów komórek krwiotwórczych. Aby przetestować tę hipotezę, przeanalizowaliśmy częstotliwości polimorfizmów pojedynczych nukleotydów (SNP) dla czterech kandydujących genów TLR w kohorcie biorców przeszczepów komórek krwiotwórczych i niespokrewnionych dawców. Metody
Pacjenci
Wszyscy pacjenci, którzy otrzymali allogeniczny przeszczep komórek krwiotwórczych z ośrodka badawczego Fred Hutchinson Cancer Research Center i Seattle Cancer Care Alliance w latach 1989-2004, kwalifikowali się do tej analizy. Uzyskano próbki i DNA wyodrębniono za pomocą naszego Programu Immunogenetyki Człowieka w ciągłym procesie, który opierał się wyłącznie na dostępności próbek i nie podano żadnych preferencji dla żadnych konkretnych zmiennych klinicznych. W przypadku badań odkrywczych i walidacyjnych pacjenci zostali wybrani sekwencyjnie z ogólnej puli próbek dostępnych w czasie, gdy przeprowadzono odpowiednie badania, a żaden pacjent nie był włączony do obu badań. Czytaj dalej Toll-like Receptor Receptor 4 i Aspergillosis w transplantacji komórek macierzystych ad

Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego cd

Do analiz K-ras zastosowano następujące zagnieżdżone zestawy starterów dla eksonu 2: huKRAS2 ex2F, 5 GAATGGTCCTGCACCAGTAA3 ; huKRAS2 ex2R, 5 GTGTGACATGTTCTAATATAGTCA3 ; huKRAS ex2Fint, 5 GTCCTGCACCAGTAATATGC3 ; i huKRAS2 ex2Rint, 5 ATGTTCTAATATAGTCACATTTTC3 . Każdy koktajl po 25 .l reakcji łańcuchowej polimerazy (PCR) zawierał co najmniej 15 ng genomowego DNA, 2,5 mM chlorku magnezu, 300 mM trifosforanów deoksynukleotydu i 2,5 U polimerazy DNA AmpliTaq Gold (Applied Biosystems). Warunki PCR były następujące: cykl w 94 ° C przez 10 minut; 45 cykli w 94 ° C przez 30 sekund, 64 ° C przez 30 sekund i 72 ° C przez 30 sekund; następnie cykl w 72 ° C przez 7 minut. Sekwencjonowanie wydłużania startera przeprowadzono za pomocą zestawu do sekwencjonowania cykli BigDye Terminator v3.1 (Applied Biosystems). Reakcje przeprowadzono na analizatorze DNA 3730×1 (Applied Biosystems). Czytaj dalej Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego cd

Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego ad

Oceniliśmy także związek statusu mutacji K-ras z przeżywalnością całkowitą i czasem przeżycia bez progresji u pacjentów otrzymujących tylko najlepszą opiekę wspomagającą. Metody
Komitet badań, który obejmował członków NCIC CTG i AGITG zaprojektował badanie. NCIC CTG zebrała i przeanalizowała dane oraz zachowała pełne, nieograniczone prawo do przekazywania danych do publikacji. Jeden z autorów akademickich dokonał przeglądu wszystkich danych, inny przeprowadził analizy statystyczne, a trzeci napisał pierwszy szkic manuskryptu; autorzy zapewniają rękojmię za kompletność i dokładność prezentowanych danych. Pierwotny projekt manuskryptu został przejrzany i skomentowany przez wszystkich autorów, a także przez pracowników Bristol-Myers Squibb, którzy nie wprowadzili istotnych zmian. Czytaj dalej Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego ad