Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego cd

Do analiz K-ras zastosowano następujące zagnieżdżone zestawy starterów dla eksonu 2: huKRAS2 ex2F, 5 GAATGGTCCTGCACCAGTAA3 ; huKRAS2 ex2R, 5 GTGTGACATGTTCTAATATAGTCA3 ; huKRAS ex2Fint, 5 GTCCTGCACCAGTAATATGC3 ; i huKRAS2 ex2Rint, 5 ATGTTCTAATATAGTCACATTTTC3 . Każdy koktajl po 25 .l reakcji łańcuchowej polimerazy (PCR) zawierał co najmniej 15 ng genomowego DNA, 2,5 mM chlorku magnezu, 300 mM trifosforanów deoksynukleotydu i 2,5 U polimerazy DNA AmpliTaq Gold (Applied Biosystems). Warunki PCR były następujące: cykl w 94 ° C przez 10 minut; 45 cykli w 94 ° C przez 30 sekund, 64 ° C przez 30 sekund i 72 ° C przez 30 sekund; następnie cykl w 72 ° C przez 7 minut. Sekwencjonowanie wydłużania startera przeprowadzono za pomocą zestawu do sekwencjonowania cykli BigDye Terminator v3.1 (Applied Biosystems). Reakcje przeprowadzono na analizatorze DNA 3730×1 (Applied Biosystems). Czytaj dalej Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego cd

Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego ad

Oceniliśmy także związek statusu mutacji K-ras z przeżywalnością całkowitą i czasem przeżycia bez progresji u pacjentów otrzymujących tylko najlepszą opiekę wspomagającą. Metody
Komitet badań, który obejmował członków NCIC CTG i AGITG zaprojektował badanie. NCIC CTG zebrała i przeanalizowała dane oraz zachowała pełne, nieograniczone prawo do przekazywania danych do publikacji. Jeden z autorów akademickich dokonał przeglądu wszystkich danych, inny przeprowadził analizy statystyczne, a trzeci napisał pierwszy szkic manuskryptu; autorzy zapewniają rękojmię za kompletność i dokładność prezentowanych danych. Pierwotny projekt manuskryptu został przejrzany i skomentowany przez wszystkich autorów, a także przez pracowników Bristol-Myers Squibb, którzy nie wprowadzili istotnych zmian. Czytaj dalej Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego ad

Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego

Leczenie cetuksymabem, monoklonalnym przeciwciałem skierowanym przeciwko receptorowi naskórkowego czynnika wzrostu, poprawia całkowite i wolne od progresji przeżycie i zachowuje jakość życia u pacjentów z rakiem okrężnicy i odbytu, którzy nie zareagowali na chemioterapię. Status mutacji genu K-ras w guzie może wpływać na odpowiedź na cetuksymab i mieć wartość prognostyczną niezależną od leczenia. Metody
Przeanalizowaliśmy próbki nowotworów, uzyskane od 394 z 572 pacjentów (68,9%) z rakiem jelita grubego, którzy zostali losowo przydzieleni do otrzymywania cetuksymabu z najlepszą opieką wspomagającą lub najlepszą opieką wspierającą w monoterapii w celu poszukiwania aktywujących mutacji w eksonie 2 genu K-ras. Ocenialiśmy, czy status mutacji genu K-ras był związany z przeżyciem w grupach cetuksymabu i podtrzymującej.
Wyniki
Z guzów ocenionych pod kątem mutacji K-ras, 42,3% miało co najmniej jedną mutację w eksonie 2 genu. Czytaj dalej Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego

Alemtuzumab vs. interferon beta-1a we wczesnym stwardnieniu rozsianym ad 9

Zmniejszenie obciążenia uszkodzeniem MRI z ważeniem T2 było większe u pacjentów otrzymujących alemtuzumab niż u pacjentów otrzymujących interferon beta-1a, chociaż różnica po 36 miesiącach nie była znacząca; porównania były ograniczone przez brakujące dane MRI i wysoką częstotliwość odstawiania dla interferonu beta-1a. Ta pozorna lepsza skuteczność alemtuzumabu nie była spowodowana słabą odpowiedzią na interferon beta-1a, ponieważ częstość nawrotów wśród pacjentów otrzymujących interferon beta-1a była niższa niż obserwowana w badaniach dotyczących licencjonowania 14-18. Zespół związany z infuzją związany z alemtuzumabem uniemożliwiły podwójne oślepienie.19 Dlatego wykorzystaliśmy ratera, który nie był świadomy wyników leczenia dla uzyskania wyników skuteczności, zgodnie z zaleceniem American Academy of Neurology, 20 i potwierdził pomyślne utrzymanie oślepiania podczas całego badania. Chociaż nasze badanie sugeruje, że alemtuzumab jest bardziej skuteczny niż interferon beta-1a, gdy podaje się go na najwcześniejszych etapach nawracająco-ustępującego stwardnienia rozsianego, nasze odkrycia podnoszą trudny problem ekspozycji młodych dorosłych, którzy mają niewielką niepełnosprawność na lek o potencjalnie poważnych szkodliwych skutkach. Nasze badanie fazy 2 nie było zaprojektowane do oceny długoterminowego bezpieczeństwa alemtuzumabu, ani też nie było zasilane, aby wykryć niezbyt częste zdarzenia niepożądane. Czytaj dalej Alemtuzumab vs. interferon beta-1a we wczesnym stwardnieniu rozsianym ad 9

Alemtuzumab vs. interferon beta-1a we wczesnym stwardnieniu rozsianym ad 8

Pacjent z indeksem doznał śmiertelnego krwotoku mózgowego przed rozpoznaniem. Z perspektywy czasu skórne oznaki immunologicznej plamicy małopłytkowej występowały od kilku tygodni, ale nie były zgłaszane. Spośród sześciu pacjentów otrzymujących alemtuzumab, u których rozwinęła się immunologiczna plama małopłytkowa, czterech otrzymywało dawkę 24 mg (trzech pacjentów po dwóch cyklach i jeden po trzech), a dwóch otrzymywało dawkę 12 mg (obie po trzech cyklach). U 2 pacjentów wystąpiła remisja układu immunologicznego z plamicą małopłytkową bez leczenia u jednego pacjenta, po leczeniu kortykosteroidami u dwóch pacjentów i po leczeniu rytuksymabem u dwóch pacjentów. Małopłytkowość stopnia 2 rozwinęła się u jednego pacjenta po 3 miesiącach otrzymywania interferonu beta-1a; ten stan utrzymywał się pomimo wycofania interferonu beta-1a i pozostał na poziomie pod koniec badania po ponownym wprowadzeniu interferonu beta-1a. Czytaj dalej Alemtuzumab vs. interferon beta-1a we wczesnym stwardnieniu rozsianym ad 8

Alemtuzumab vs. interferon beta-1a we wczesnym stwardnieniu rozsianym ad 7

Redukcja była bardziej wyraźna po leczeniu alemtuzumabem niż w przypadku interferonu beta-1a (P = 0,005), ze znaczącymi redukcjami w stosunku do wartości wyjściowych w miesiącach 12 (P = 0,01) i 24 (P = 0,005). Różnice w medianie zmian w 36 miesiącu nie były znaczące. Warto zauważyć, że wielkość próby dla 36-miesięcznych analiz została zmniejszona ze względu na liczbę pacjentów, którzy przerwali badanie i 26 pacjentów, którzy mieli brakujące lub technicznie niedostateczne skany MRI. Zmniejszenie objętości mózgu między początkiem a 36 miesiącem było istotnie mniejsze u pacjentów otrzymujących alemtuzumab niż u osób otrzymujących interferon beta-1a (odpowiednio -0,5% i -1,8%, P = 0,05). Uznając, że pomiary atrofii mogą zostać zakłócone przez wczesne stłumienie zmian zapalnych zajmujących przestrzeń, przeanalizowaliśmy objętość mózgu między 12 a 36 miesiącem życia; pomiar ten zmniejszył się o 0,2% wśród pacjentów otrzymujących interferon beta-1a, ale był podwyższony o 0,9% u osób otrzymujących alemtuzumab (P = 0,02) (tabela 2). Czytaj dalej Alemtuzumab vs. interferon beta-1a we wczesnym stwardnieniu rozsianym ad 7

Alemtuzumab vs. interferon beta-1a we wczesnym stwardnieniu rozsianym ad 6

W przypadku dawki 12 mg ryzyko trwałej niepełnosprawności zostało zmniejszone o 75% (współczynnik ryzyka, 0,25, 95% CI, 0,11 do 0,57, P <0,001); w przypadku dawki 24 mg zmniejszenie ryzyka wyniosło 67% (współczynnik ryzyka, 0,33, 95% CI, 0,16 do 0,69, P = 0,003). Liczba pacjentów, którzy wymagaliby leczenia alemtuzumabem zamiast interferonu beta-1a w celu uniknięcia jednej trwałej niepełnosprawności w ciągu 36 miesięcy wyniosła 5,8 (5,6 dla dawki 12 mg i 6,0 dla dawki 24 mg). W analizie wrażliwości ryzyka utrzymującej się niepełnosprawności po 3 miesiącach redukcja ryzyka wyniosła 64% (współczynnik ryzyka, 0,36, 95% CI, 0,21 do 0,60, P <0,001). W obu grupach alemtuzumabu średni wynik niepełnosprawności na EDSS, który wynosił 1,9 punktu na początku badania, poprawił się o 0,39 punktu (95% CI, 0,23 do 0,55) po 36 miesiącach: 0,32 punktu dla dawki 12 mg (P = 0,006). i 0,45 punktu dla dawki 24 mg (P = 0,001). Czytaj dalej Alemtuzumab vs. interferon beta-1a we wczesnym stwardnieniu rozsianym ad 6

Alemtuzumab vs. interferon beta-1a we wczesnym stwardnieniu rozsianym ad 5

Wszystkie oceny bezpieczeństwa i skuteczności przebiegały zgodnie z planem, a pacjenci otrzymujący interferon beta-1a nadal przyjmowali lek. W momencie zawieszenia dawki, tylko 2 kwalifikujących się pacjentów (1%) nie otrzymało drugiego cyklu alemtuzumabu w 12. miesiącu, podczas gdy 155 pacjentów (75%) było wykluczonych z otrzymywania trzeciego cyklu alemtuzumabu w 24. miesiącu. program zapewniający szybką identyfikację i właściwe postępowanie z plamicą małopłytkową immunologiczną. Czytaj dalej Alemtuzumab vs. interferon beta-1a we wczesnym stwardnieniu rozsianym ad 5

Alemtuzumab vs. interferon beta-1a we wczesnym stwardnieniu rozsianym czesc 4

Odsetek pacjentów z przeżyciem bez nawrotów oceniano za pomocą regresji logistycznej. Szacowany odsetek pacjentów z utrzymującą się niepełnosprawnością lub nawrotem został wygenerowany metodą Kaplana-Meiera. Zanalizowany wskaźnik nawrotu oszacowano za pomocą regresji Poissona. Liczba pacjentów, którzy wymagali leczenia alemtuzumabem zamiast interferonu beta-1a, aby zapobiec jednemu pacjentowi z nawrotem lub utrzymującą się niepełnosprawnością została obliczona zgodnie z odsetkiem pacjentów, którzy nie mieli tych wyników w miesiącu 36.11. Porównanie wyników EDSS opierały się na powtarzanej analizie kowariancji. Czytaj dalej Alemtuzumab vs. interferon beta-1a we wczesnym stwardnieniu rozsianym czesc 4

Alemtuzumab vs. interferon beta-1a we wczesnym stwardnieniu rozsianym cd

Pacjenci z podwyższonym poziomem niepełnosprawności mogą zostać przerwani z badania. Nawrót został zdefiniowany jako nowy lub nasilający się objaw z obiektywną zmianą w badaniu neurologicznym przypisywanym stwardnieniu rozsianemu, które trwało co najmniej 48 godzin, które były obecne w normalnej temperaturze ciała, i które były poprzedzone co najmniej 30 dniami stabilności klinicznej. Drugorzędnymi wynikami były proporcje pacjentów, którzy nie mieli nawrotu, zmian w obciążeniu zmianami (jak widać na MRI z ważeniem T2) i objętość mózgu (mierzoną metodą Losseff na MRI8 ważonym T1). Skany MRI były wykonywane co roku i interpretowane przez neuroradiologa w Perceptive Informatics, który był nieświadomy przypisań do grup badawczych.
Czynność tarczycy i poziomy przeciwciał przeciw receptorowi antytyropiny i subpopulacji limfocytów mierzono co kwartał w centralnym laboratorium (Cirion Clinical Trial Services i Charles River Laboratories). Czytaj dalej Alemtuzumab vs. interferon beta-1a we wczesnym stwardnieniu rozsianym cd