Zatrucie acetaminofenem

Heard (numer z 17 lipca) donosi, że acetylocysteina zmniejsza nasilenie uszkodzenia wątroby wywołanego przez zatrucie paracetamolem, przywracając wątrobową pulę glutationową. Jednak jednym z głównych problemów, o których nie wspomniano w artykule, jest możliwe obniżenie wskaźnika protrombiny (określonego w legendzie do ryciny 1), prognostycznego wskaźnika hepatotoksyczności.
Tabela 1. Tabela 1. Zmiany poziomu acetaminofenu w surowicy, wskaźnika protrombiny i aminotransferazy podczas leczenia acetylocysteiną w przypadku zatrucia acetaminofenem. Czytaj dalej Zatrucie acetaminofenem

Genomika i medycyna klinicznaTranslacyjne badania w genetyce i genomice ad

Są to ważne i interesujące kwestie, ale znaczna część materiału jest przedstawiona w nieprzeniknionym stylu i wydaje się być oderwana od reszty książki. Genomika i medycyna kliniczna mogą być używane podczas pierwszego lub drugiego roku szkoły medycznej, aby zapewnić podstawy genomiki jako tematu jednoczącego dla różnych dziedzin tematów, które są zwykle nauczane w tym czasie. Podstawowi badacze i ciekawi klinicyści również znajdą wiele rzeczy do nauczenia się i być może na ich bazie. Ale jest to książka przejściowa, która pojawiła się zanim genomiczny zestaw myśli został przyswojony jako nowy sposób nauczania i praktykowania medycyny.
Natomiast Moyra Smith, autor Translational Research in Genetics and Genomics, przyjmuje za pewnik, że żyjemy już w erze genomu i wyjaśnia, w jaki sposób różne genomiczne mechanizmy i zjawiska są zaangażowane w przyczyny choroby i jak ta wiedza może prowadzić do nowych metod leczenia i metod diagnozy. Czytaj dalej Genomika i medycyna klinicznaTranslacyjne badania w genetyce i genomice ad

Genomika i medycyna klinicznaTranslacyjne badania w genetyce i genomice

Śmierć w lipcu 2008 r. Victora A. McKusicka oznaczała koniec ery. McKusick, powszechnie uważany za twórcę genetyki medycznej, nadał zarówno nazwę, jak i ważną tożsamość nowej dyscyplinie naukowej – genomice – kiedy wraz z Frankiem Ruddle em założyli nowe czasopismo o tej nazwie 3 lata przed wprowadzeniem na rynek ludzki w 1990 r. Projekt genomu. Czytaj dalej Genomika i medycyna klinicznaTranslacyjne badania w genetyce i genomice

Skutki sercowo-naczyniowe po zmianie zasad dotyczących recept na klopidogrel cd

Sprawozdania z programu ODB wskazały, że w kwietniu 2002 r. Do marca 2003 r. Około 90% wniosków o klopidogrel zostało zatwierdzonych po ocenie klinicznej w procesie uprzedniego zezwolenia. Aby poprawić efektywność systemu, płatnik zmienił politykę z uprzedniej zgody na ograniczone użycie we wrześniu 2003 r. Polityka ograniczonego użytkowania złagodziła ograniczenia przed wydaniem zezwolenia, zezwalając na stosowanie klopidogrelu do zatwierdzonych wskazań zgodnie z wcześniej określonymi kodami przepisywania, w tym ostre zespoły wieńcowe i PCI, co ułatwiło szybszy dostęp do klopidogrelu dla tych wskazań. Czytaj dalej Skutki sercowo-naczyniowe po zmianie zasad dotyczących recept na klopidogrel cd

Skutki sercowo-naczyniowe po zmianie zasad dotyczących recept na klopidogrel ad

W badaniu tym oceniono wpływ na populację układu sercowo-naczyniowego zmiany w polityce dotyczącej uprzedniego zezwolenia na politykę ograniczonego stosowania klopidogrelu. Metody
Projektowanie i źródła danych
Przeprowadziliśmy retrospektywną, populacyjną analizę szeregów czasowych z wykorzystaniem powiązanych baz danych opieki zdrowotnej w Ontario w Kanadzie. W okresie od kwietnia 2000 r. Do 31 marca 2005 r. Liczba ludności Ontario wynosiła około 12,3 miliona, z czego około 1,5 miliona było w wieku 65 lat lub starszych. Czytaj dalej Skutki sercowo-naczyniowe po zmianie zasad dotyczących recept na klopidogrel ad

Skutki sercowo-naczyniowe po zmianie zasad dotyczących recept na klopidogrel

Pacjenci z zawałem mięśnia sercowego z uniesieniem odcinka ST mogą otrzymywać stenty wieńcowe w ramach ostrej rewaskularyzacji z pierwotną przezskórną interwencją wieńcową (PCI), podczas gdy pacjenci z ostrymi zespołami wieńcowymi mogą podlegać PCI z implantacją stentu w ramach strategii wczesnego leczenia inwazyjnego.1,2 Klopidogrel plus kwas acetylosalicylowy jest zalecany pacjentom otrzymującym stenty nagie lub stenty uwalniające leki, ponieważ wykazano, że ten podwójny schemat przeciwpłytkowy zmniejsza zakrzepicę w stencie, a u pacjentów poddawanych PCI w ostrych zespołach wieńcowych z niedotlenieniem wskaźnik zgonu z przyczyn sercowo-naczyniowych, zawału mięśnia sercowego lub udaru mózgu.1.3 Wytyczne sugerują, że wszyscy pacjenci powinni otrzymywać klopidogrel przed poddaniem się PCI i kontynuować przyjmowanie leku bezpośrednio po zabiegu przez co najmniej miesiąc w przypadku gołych metalowych stentów, przez 3 miesiące w przypadku stentów sirolimus i przez 6 miesięcy w przypadku stentów paklitakselowych. Nowsze zalecenia dotyczą tego, że pacjenci powinni kontynuować przyjmowanie klopidogrelu przez co najmniej rok po założeniu stentu uwalniającego lek ze względu na obawy o zakrzepicę w późnym stencie.1,4
Tak jak klinicyści mogą opóźniać wprowadzenie nowych dowodów, polityka lekowa może również pozostawać w tyle za szybko rozwijającymi się dowodami klinicznymi. Ponadto decydenci muszą zrównoważyć dowody i koszty.5 Ponieważ wydatki na leki są jednym z najszybciej rosnących kosztów w systemie opieki zdrowotnej, istnieje obawa, że eskalacja wydatków może wkrótce przekroczyć zdolność rządów i płatników zewnętrznych. 6 W latach 1996-2001 odkryliśmy, że koszty leków stosowanych w chorobach sercowo-naczyniowych w Kanadzie są prawie dwukrotnie wyższe.7 Jako takie, wiele leków, które są drogie lub mają zalety ograniczone do określonych populacji, takich jak klopidogrel, które kosztują około 4 USD (w dolarach amerykańskich) dziennie , często ograniczali zwrot kosztów przez płatników w celu kontrolowania nieuzasadnionego i nadmiernego używania, a tym samym potencjalnie obniżenia kosztów leczenia w programach ubezpieczenia leków. Stosowanie polityki uprzedniego wydawania zezwoleń, która ogranicza stosowanie leków poprzez wymaganie wcześniejszej zgody od ubezpieczyciela, zyskało popularność zarówno w Stanach Zjednoczonych, jak i Kanadzie jako metoda ograniczenia kosztów. Czytaj dalej Skutki sercowo-naczyniowe po zmianie zasad dotyczących recept na klopidogrel

Przesuwa się z czasu na letni i z zachorowalności na zawał mięśnia sercowego

Ponad 1,5 miliarda mężczyzn i kobiet jest narażonych na zmiany związane z czasem letnim: odwracanie zegarów o godzinę na wiosnę i do tyłu o godzinę na jesieni. Te przejścia mogą zakłócać rytmy chronobiologiczne i wpływać na czas trwania i jakość snu, a efekt utrzymuje się przez kilka dni po zmianach.1,2
Zbadaliśmy wpływ tych przejść na częstość występowania ostrego zawału mięśnia sercowego. Aby obliczyć współczynnik zachorowalności, porównaliśmy częstość występowania ostrego zawału mięśnia sercowego podczas każdego z pierwszych 7 dni po przejściu wiosennym lub jesiennym oraz średnią częstości występowania w odpowiednie dni powszednie 2 tygodnie przed i 2 tygodnie po dniu zainteresowania. Na przykład, na wtorek po przejściu, podzielilibyśmy częstość w ten wtorek przez średnią częstość we wtorek 2 tygodnie wcześniej i częstość we wtorek 2 tygodnie później. Wykorzystaliśmy dane ze szwedzkiego rejestru ostrego zawału mięśnia sercowego, który dostarcza wysokiej jakości informacje o wszystkich ostrych zawałach mięśnia sercowego w kraju od 1987 roku. Czytaj dalej Przesuwa się z czasu na letni i z zachorowalności na zawał mięśnia sercowego

Wyzwanie podtypu różnorodności podtypu HIV-1

Po opublikowaniu naszego artykułu przeglądowego na temat różnorodności podtypu ludzkiego wirusa upośledzenia typu (HIV-1) (problem z 10 kwietnia), dane cytowane w pierwszym wierszu tabeli 3 w naszym artykule, z abstraktu autorstwa Nkengafac i wsp.2 (odniesienie 68 w naszym artykule), zostały wycofane przez autorów, z powodu naruszenia rzetelności naukowej.3 Tak więc, w wersji online naszego artykułu, pierwszy wiersz naszej Tabeli 3 został usunięty i odniesienie 68 jest odnotowane jako mające został wycofany.
Ponadto przynależność do dr Francine E. McCutchan (strona 1590) powinna być programem badawczym wojskowego wirusa HIV w USA, Henry M. Jackson Foundation for Advancement of Military Medicine, Rockville, MD i pod Klasyfikacja i epidemiologia molekularna wirusa HIV (strona 1591), drugie zdanie powinno zaczynać się od podtypów i podtypów .
Barbara S. Czytaj dalej Wyzwanie podtypu różnorodności podtypu HIV-1

Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego cd

Do analiz K-ras zastosowano następujące zagnieżdżone zestawy starterów dla eksonu 2: huKRAS2 ex2F, 5 GAATGGTCCTGCACCAGTAA3 ; huKRAS2 ex2R, 5 GTGTGACATGTTCTAATATAGTCA3 ; huKRAS ex2Fint, 5 GTCCTGCACCAGTAATATGC3 ; i huKRAS2 ex2Rint, 5 ATGTTCTAATATAGTCACATTTTC3 . Każdy koktajl po 25 .l reakcji łańcuchowej polimerazy (PCR) zawierał co najmniej 15 ng genomowego DNA, 2,5 mM chlorku magnezu, 300 mM trifosforanów deoksynukleotydu i 2,5 U polimerazy DNA AmpliTaq Gold (Applied Biosystems). Warunki PCR były następujące: cykl w 94 ° C przez 10 minut; 45 cykli w 94 ° C przez 30 sekund, 64 ° C przez 30 sekund i 72 ° C przez 30 sekund; następnie cykl w 72 ° C przez 7 minut. Sekwencjonowanie wydłużania startera przeprowadzono za pomocą zestawu do sekwencjonowania cykli BigDye Terminator v3.1 (Applied Biosystems). Reakcje przeprowadzono na analizatorze DNA 3730×1 (Applied Biosystems). Czytaj dalej Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego cd

Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego ad

Oceniliśmy także związek statusu mutacji K-ras z przeżywalnością całkowitą i czasem przeżycia bez progresji u pacjentów otrzymujących tylko najlepszą opiekę wspomagającą. Metody
Komitet badań, który obejmował członków NCIC CTG i AGITG zaprojektował badanie. NCIC CTG zebrała i przeanalizowała dane oraz zachowała pełne, nieograniczone prawo do przekazywania danych do publikacji. Jeden z autorów akademickich dokonał przeglądu wszystkich danych, inny przeprowadził analizy statystyczne, a trzeci napisał pierwszy szkic manuskryptu; autorzy zapewniają rękojmię za kompletność i dokładność prezentowanych danych. Pierwotny projekt manuskryptu został przejrzany i skomentowany przez wszystkich autorów, a także przez pracowników Bristol-Myers Squibb, którzy nie wprowadzili istotnych zmian. Czytaj dalej Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego ad