Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego cd

Do analiz K-ras zastosowano następujące zagnieżdżone zestawy starterów dla eksonu 2: huKRAS2 ex2F, 5 GAATGGTCCTGCACCAGTAA3 ; huKRAS2 ex2R, 5 GTGTGACATGTTCTAATATAGTCA3 ; huKRAS ex2Fint, 5 GTCCTGCACCAGTAATATGC3 ; i huKRAS2 ex2Rint, 5 ATGTTCTAATATAGTCACATTTTC3 . Każdy koktajl po 25 .l reakcji łańcuchowej polimerazy (PCR) zawierał co najmniej 15 ng genomowego DNA, 2,5 mM chlorku magnezu, 300 mM trifosforanów deoksynukleotydu i 2,5 U polimerazy DNA AmpliTaq Gold (Applied Biosystems). Warunki PCR były następujące: cykl w 94 ° C przez 10 minut; 45 cykli w 94 ° C przez 30 sekund, 64 ° C przez 30 sekund i 72 ° C przez 30 sekund; następnie cykl w 72 ° C przez 7 minut. Sekwencjonowanie wydłużania startera przeprowadzono za pomocą zestawu do sekwencjonowania cykli BigDye Terminator v3.1 (Applied Biosystems). Reakcje przeprowadzono na analizatorze DNA 3730×1 (Applied Biosystems). Analizy sekwencji DNA wykonano przy użyciu Mutation Surveyor v2.61 (SoftGenetics), wraz z oględzinami każdej próbki śladowej zarówno w kierunku do przodu jak i do tyłu. Odpowiednie pozytywne i negatywne kontrole zostały włączone do K-ras. Osoby, które przeprowadziły analizy mutacji, nie wiedziały o wyniku klinicznym. Analiza statystyczna
Wszystkie analizy statystyczne zostały wykonane przez NCIC CTG zgodnie z protokołem do analizy statystycznej, który został napisany przed dokonaniem oceny mutacji K-ras. Wszystkich losowo przydzielonych pacjentów, dla których dostępne były dane na temat statusu mutacji K-ras, włączono do analizy. Całkowite przeżycie, główny punkt końcowy, zostało zdefiniowane jako czas od randomizacji do śmierci z dowolnej przyczyny. Drugorzędnymi punktami końcowymi były przeżycie wolne od progresji, zdefiniowane jako czas od randomizacji do pierwszych obiektywnych dowodów postępu choroby lub śmierci z dowolnej przyczyny; wskaźniki odpowiedzi, określone zgodnie z kryteriami oceny odpowiedzi w przypadku guzów litych (RECIST); i jakość życia, oceniane za pomocą kwestionariusza jakości życia (QLQ-C30) Europejskiej Organizacji Badań i Leczenia Raka (EORTC). Testy Wilcoxona zastosowano do porównania dwóch grup leczenia pod względem średniej zmiany od wartości wyjściowej w skali globalnej jakości życia. Za istotną klinicznie uznano różnicę większą niż 10 punktów.12
Przeżywalność pacjentów w każdej grupie mutacji K-ras i grupie leczenia podsumowano za pomocą krzywych Kaplana-Meiera, a różnicę między tymi grupami porównano z zastosowaniem testu log-rank, ze współczynnikiem ryzyka i jego liczbą. 95% przedziały ufności obliczone z modelu regresji Coxa z jedną zmienną towarzyszącą. Aby ocenić, czy K-ras był niezależnym czynnikiem prognostycznym dla pacjentów otrzymujących leczenie podtrzymujące, do danych dla pacjentów otrzymujących leczenie podtrzymujące zastosowano model regresji wieloczynnikowej Coxa; Obejmowały one następujące współzmienne określone przez protokół: Stan wydajności Wschodniej Spółdzielni Onkologicznej (ECOG) (0 lub w porównaniu 2, w skali od 0 do 5, z niższymi wynikami reprezentującymi wyższy poziom funkcjonowania), płeć (mężczyzna vs żeński), wiek (.65 lat vs. <65 lat), wyjściowy poziom dehydrogenazy mleczanowej (wyższy niż górna granica normalnego zakresu [hasła pokrewne: ciąża, ginekolog Warszawa, Ginekolog łódź ]

Powiązane tematy z artykułem: ciąża Ginekolog łódź ginekolog Warszawa