Alogliptyna po ostrym zespole wieńcowym u pacjentów z cukrzycą typu 2

Aby ocenić potencjalnie podwyższone ryzyko sercowo-naczyniowe związane z nowymi lekami przeciwhiperglikemicznymi u pacjentów z cukrzycą typu 2, agencje regulacyjne wymagają kompleksowej oceny profilu bezpieczeństwa sercowo-naczyniowego nowych terapii przeciwcukrzycowych. Oceniliśmy wyniki sercowo-naczyniowe za pomocą alogliptyny, nowego inhibitora peptydazy dipeptydylowej 4 (DPP-4), w porównaniu z placebo u pacjentów z cukrzycą typu 2, którzy mieli niedawno ostry ...

Ogólnoświatowa mapa polimorfizmu Plasmodium falciparum K13-Propeller ad 5

Wartości procentowe dla Czadu i Gambii pochodziły z próbki o wielkości mniejszej niż 50. Szczegóły dotyczące pobierania próbek i zróżnicowania K13 w zależności od kraju podano w tabelach S4, S5 i S7 oraz na rysunku S3 w dodatkowym dodatku. CAR oznacza Republikę Środkowoafrykańską. Ryc. 2. Ryc. 2. Rozkład częstości alleli K13 typu dzikiego. Pokazane są rozkłady allelu K13 dzikiego typu w Azji (panel A) i na całym świecie (panel B). Obszary, w...

Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego cd

Do analiz K-ras zastosowano następujące zagnieżdżone zestawy starterów dla eksonu 2: huKRAS2 ex2F, 5 GAATGGTCCTGCACCAGTAA3 ; huKRAS2 ex2R, 5 GTGTGACATGTTCTAATATAGTCA3 ; huKRAS ex2Fint, 5 GTCCTGCACCAGTAATATGC3 ; i huKRAS2 ex2Rint, 5 ATGTTCTAATATAGTCACATTTTC3 . Każdy koktajl po 25 .l reakcji łańcuchowej polimerazy (PCR) zawierał co najmniej 15 ng genomowego DNA, 2,5 mM chlorku magnezu, 300 mM trifosforanów deoksynukleotydu i 2,5 U polimerazy DNA AmpliTaq Gold (Appl...

szpita grudziądz ad 8

Stwierdzono, bowiem, że żółtaczki miąższowe występują częściej i przebiegają groźniej u ludzi, u których stwierdza się przewlekłe niedożywienie białkowe. Żółtaczka miąższowa zewnętrznie nie różni się od żółtaczki mechanicznej, lecz w zależności od czynnika, który wywołuje zmiany martwicze w wątrobie, zmienia się przebieg kliniczny żółtaczki. Żółtaczka, bowiem, jako objaw schorzenia wątroby, może przebiegać ciężko lub łagodnie, co ...

Najnowsze zdjęcia w galerii eginekologwarszawa.edu:

327#rak podstawnokomórkowy rokowania , #polskie towarzystwo ginekologiczne rekomendacje , #stolec owczy , #błona odblaskowa , #garnuszek na klocuszek allegro , #ginekolog na nfz białystok , #jak zmierzyć rozmiar biustu , #choroba weila , #depulpin , #ginekolog nfz białystok ,