Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego cd

Do analiz K-ras zastosowano następujące zagnieżdżone zestawy starterów dla eksonu 2: huKRAS2 ex2F, 5 GAATGGTCCTGCACCAGTAA3 ; huKRAS2 ex2R, 5 GTGTGACATGTTCTAATATAGTCA3 ; huKRAS ex2Fint, 5 GTCCTGCACCAGTAATATGC3 ; i huKRAS2 ex2Rint, 5 ATGTTCTAATATAGTCACATTTTC3 . Każdy koktajl po 25 .l reakcji łańcuchowej polimerazy (PCR) zawierał co najmniej 15 ng genomowego DNA, 2,5 mM chlorku magnezu, 300 mM trifosforanów deoksynukleotydu i 2,5 U polimerazy DNA AmpliTaq Gold (Applied Biosystems). Warunki PCR były następujące: cykl w 94 ° C przez 10 minut; 45 cykli w 94 ° C przez 30 sekund, 64 ° C przez 30 sekund i 72 ° C przez 30 sekund; następnie cykl w 72 ° C przez 7 minut. Sekwencjonowanie wydłużania startera przeprowadzono za pomocą zestawu do sekwencjonowania cykli BigDye Terminator v3.1 (Applied Biosystems). Reakcje przeprowadzono na analizatorze DNA 3730×1 (Applied Biosystems). Czytaj dalej Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego cd

Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego ad

Oceniliśmy także związek statusu mutacji K-ras z przeżywalnością całkowitą i czasem przeżycia bez progresji u pacjentów otrzymujących tylko najlepszą opiekę wspomagającą. Metody
Komitet badań, który obejmował członków NCIC CTG i AGITG zaprojektował badanie. NCIC CTG zebrała i przeanalizowała dane oraz zachowała pełne, nieograniczone prawo do przekazywania danych do publikacji. Jeden z autorów akademickich dokonał przeglądu wszystkich danych, inny przeprowadził analizy statystyczne, a trzeci napisał pierwszy szkic manuskryptu; autorzy zapewniają rękojmię za kompletność i dokładność prezentowanych danych. Pierwotny projekt manuskryptu został przejrzany i skomentowany przez wszystkich autorów, a także przez pracowników Bristol-Myers Squibb, którzy nie wprowadzili istotnych zmian. Czytaj dalej Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego ad

Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego

Leczenie cetuksymabem, monoklonalnym przeciwciałem skierowanym przeciwko receptorowi naskórkowego czynnika wzrostu, poprawia całkowite i wolne od progresji przeżycie i zachowuje jakość życia u pacjentów z rakiem okrężnicy i odbytu, którzy nie zareagowali na chemioterapię. Status mutacji genu K-ras w guzie może wpływać na odpowiedź na cetuksymab i mieć wartość prognostyczną niezależną od leczenia. Metody
Przeanalizowaliśmy próbki nowotworów, uzyskane od 394 z 572 pacjentów (68,9%) z rakiem jelita grubego, którzy zostali losowo przydzieleni do otrzymywania cetuksymabu z najlepszą opieką wspomagającą lub najlepszą opieką wspierającą w monoterapii w celu poszukiwania aktywujących mutacji w eksonie 2 genu K-ras. Ocenialiśmy, czy status mutacji genu K-ras był związany z przeżyciem w grupach cetuksymabu i podtrzymującej.
Wyniki
Z guzów ocenionych pod kątem mutacji K-ras, 42,3% miało co najmniej jedną mutację w eksonie 2 genu. Czytaj dalej Mutacje K-ras i korzyści z Cetuksymabu w zaawansowanym raku jelita grubego

Alemtuzumab vs. interferon beta-1a we wczesnym stwardnieniu rozsianym ad 9

Zmniejszenie obciążenia uszkodzeniem MRI z ważeniem T2 było większe u pacjentów otrzymujących alemtuzumab niż u pacjentów otrzymujących interferon beta-1a, chociaż różnica po 36 miesiącach nie była znacząca; porównania były ograniczone przez brakujące dane MRI i wysoką częstotliwość odstawiania dla interferonu beta-1a. Ta pozorna lepsza skuteczność alemtuzumabu nie była spowodowana słabą odpowiedzią na interferon beta-1a, ponieważ częstość nawrotów wśród pacjentów otrzymujących interferon beta-1a była niższa niż obserwowana w badaniach dotyczących licencjonowania 14-18. Zespół związany z infuzją związany z alemtuzumabem uniemożliwiły podwójne oślepienie.19 Dlatego wykorzystaliśmy ratera, który nie był świadomy wyników leczenia dla uzyskania wyników skuteczności, zgodnie z zaleceniem American Academy of Neurology, 20 i potwierdził pomyślne utrzymanie oślepiania podczas całego badania. Chociaż nasze badanie sugeruje, że alemtuzumab jest bardziej skuteczny niż interferon beta-1a, gdy podaje się go na najwcześniejszych etapach nawracająco-ustępującego stwardnienia rozsianego, nasze odkrycia podnoszą trudny problem ekspozycji młodych dorosłych, którzy mają niewielką niepełnosprawność na lek o potencjalnie poważnych szkodliwych skutkach. Nasze badanie fazy 2 nie było zaprojektowane do oceny długoterminowego bezpieczeństwa alemtuzumabu, ani też nie było zasilane, aby wykryć niezbyt częste zdarzenia niepożądane. Czytaj dalej Alemtuzumab vs. interferon beta-1a we wczesnym stwardnieniu rozsianym ad 9